The Prevalence of Panton-Valentine Lukocidin Gene in <i>Staphylococcus aureus</i> Species Isolated From Nosocomial Infections in Isfahan, Iran

Fahimeh Nourbakhsh; Samaneh Borooni; Elaheh Tajbakhsh

doi:10.5812/ajcmi.60088

The Prevalence of Panton-Valentine Lukocidin Gene in Staphylococcus aureus Species Isolated From Nosocomial Infections in Isfahan, Iran

Fahimeh Nourbakhsh ^{1 , *} , Samaneh Borooni ² and Elaheh Tajbakhsh ³

Authors Information

¹ Department of Pharmacodynamics and Toxicology, School of Pharmacy, Mashhad University of Medical Sciences, Mashhad, IR Iran

² Nourdanesh Institute of Higher Education of Meymeh, Esfahan, IR Iran

³ Associated Professor, Department of Microbiology, Islamic Azad University, Shahrekord Branch, Shahrekord, IR Iran

Article information

Avicenna Journal of Clinical Microbiology and Infection: February 2018, 5 (1); e60088
Published Online: February 25, 2018
Article Type: Research Article
Received: August 12, 2017
Revised: December 27, 2017
Accepted: January 7, 2018
DOI: 10.5812/ajcmi.60088

To Cite: Nourbakhsh F, Borooni S, Tajbakhsh E. The Prevalence of Panton-Valentine Lukocidin Gene in Staphylococcus aureus Species Isolated From Nosocomial Infections in Isfahan, Iran, Avicenna J Clin Microb Infec. 2018 ;5(1):e60088. doi: 10.5812/ajcmi.60088.

Abstract

Copyright © 2018, Avicenna Journal of Clinical Microbiology and Infection. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited

1. Background

Increased bacterial resistance to antibacterial agents due to indiscriminate use may result in an inexpressive array of substances to battle some bacterial infections; it shows the importance of antibiotic resistance pattern in Staphylococcus aureus (S. aureus) known for a long time as a principal pathogen of hospital-acquired infections (1).

One of the most important virulence factors of these bacteria is leucocidin (PVL), which are toxins with 2 separate synergic conformations. Infections caused by these bacteria are mainly controlled with antibiotics such as methicillin or aminoglycosides, which their resistance pattern changes every day. Methicillin is the first-line treatment and resistant to it in Staphylococcus aureus is mediated by a penicillin binding protein (PBP2A) encoded by the mecA gene (2).

Previous studies demonstrated that S. aureus species are the main reason for skin and soft tissue infections such as impetigo, furunculosis, bedsore, surface and surgical wounds, and abscess, and further systemic infections such as pneumonia, urinary tract infections (UTIs), and endocarditis (3).

It is suggested that panton-valentine leukocidin (PVL), as a significant virulence factor, was for the first time identified by Panton and Valentine from a supernatant suspension of S. aureus V8 isolated from a patient with chronic furunculosis infection. The important virulence factors most relevant to community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA) in many infections including pneumonia, wound infections, conjunctivitis or folliculitis are the collagen-adhesion proteins, super antigens, and the pore-forming toxins, specifically the PVL and alpha-hemolysis. Moreover, phenol-soluble modulins are produced especially in high amounts in CA-MRSA strains, whereas the production is lower in typical hospital-acquired (HA)-MRSA; but recent studies showed enough connection between community- and hospital-acquired infections (4).

The PVL includes S and F proteins, ingredients that operate interdependently and none acts by itself. These dimeric molecules are connected to each other and assemble in human polymorph nuclear cells membrane to form an octameric structure and open Ca⁺² channels. Studies found that the antibiotic resistance pattern, the frequency of the PVL gene, and the determination of different types of isolates, based on the hospital section and type of infection, were the main purposes considered in the current study. The current study aimed at determining the frequency of PVL gene in S. aureus isolated from hospital infections in Isfahan, Iran (5).

2. Methods

2.1. Bacterial Isolates

Samples were collected and S. aureus was identification in 6 months at 3 hospitals of Isfahan; 100 clinical samples from various infections were collected and 100 S. aureus species including bedsore wound (n = 23.2%), wound (n = 51.7%), abscess (19.8%), tracheal secretion (5.3%) were identified. All samples were immediately cultured on 7% sheep blood agar (Merck, Darmstadt, Germany) and incubated aerobically at 37°C for 48 hours. After incubation, suspected colonies were tested by microbiological techniques to diagnose Staphylococcus spp. (6).

According to other studies, the API-20 Staph system kit (bio Merieux, France) was also used for the final verification. the grown colonies were tested for S. aureus based on colony characteristics, Gram staining, pigment production, hemolytic activity, as well as the following biochemical reactions: catalysis activity, coagulated test (rabbit plasma), oxidase test, glucose O/F test, resistance to bacitracin (0.04 U), mannitol fermentation on mannitol salt agar (MSA) (Merck, Darmstadt, Germany), nitrate reduction, urease activity, phosphatase, deoxyribonuclease (DNase) test, novobiocin resistance, and carbohydrate fermentation tests. Five MRSA strains, NCTC10442, N315, 85/2082, CA05, and WIS (WGB8318), were used as the standard strains (7).

2.2. Antibiotic Susceptibility Testing

Staphylococcus aureus isolates were selected and then, the antibiotic resistance pattern was investigated by the disc diffusion method (on Mueller-Hinton agar). Staphylococcus aureus isolates were tested for susceptibility to penicillin (10 U), imipenem (10 μg), cefazolin (30 μg), cefalotin (30 μg), ceftriaxone (30 μg, gentamicin (10 μg, ciprofloxacin (5 μg, clindamycin (2 μg, azithromycin (15 μg, erythromycin (15 μg, mupirocin (30 μg, rifampicin (5 μg, tetracycline (30 μg, trimethoprim (5 μg, vancomycin (30 μg, and nitrofurantoin (300 μg, by the Kirby-Bauer disk diffusion method (MAST, Merseyside, England), according to Clinical and Laboratory Standards Institute (CLSI) 2011. According to other studies, S. aureus ATCC 25923 was used as the control strain (8). For DNA extraction and Staphylococcus confirmation, a generic colony of the biochemically identified S. aureus was cultivated in 1 mL trypticase soy broth (TSB) for 24 hours at 37°C, then the bacterial genomic DNA of S. aureus strains were exploited with a QIAGEN plasmid Mini Kit (Fermentas, Germany) according to manufactures’ recommendation (9).

All the isolates were tested for PVL and mecA genes by the multiplex polymerase chain reaction (M-PCR) in which standard strain NCTC 13300 was the positive control, and distilled water was the negative control. Since methicillin-resistant isolates were the highest detected strains, molecular method was used for identification too. Finally, DNA was amplified on an Eppendorf thermal cycler in a final volume of 50 μL containing 5 μL of 10x buffer, 3 μL of MgCl₂, and1.5 μL of dNTP (10 pmol), 20 pmol of each primers (Luks-F/PVL- 1 and Luks-F/pv-2), 32.5 μL of distilled water and 4 μL of the extracted DNA. Finally, the selected isolates were denatured for 5 minutes at 95°C following 35 cycles for denaturation for 30 seconds at 92°C, annealing for 30 seconds at 55°C, and extension for 45 seconds at 72°C. Eventually, final propagation was performed at 72°C for 10 minutes. PCR products were analyzed by electrophoresis through a 1.5% agarose gel. The primers used for M-PCR are shown in Table 1 (10, 11).

Table 1. Genes Primers

Gene	Sequences of Primer (5’ - 3’)	Amplicon Size, bp	Reference
Luks/F-PV	Luk PV1 5'ATCATTAGGTAAAATGTCTGCACATGATCCA3'	433	(12)
Luks/F-PV	Luk PV-2 5'GCATCAASTGTATTGGATAGCCAAAAGC3	433	(12)
MecA	F: GTAGAAATGACTGAACGTCCGATAA	310	20
MecA	R: CCAATTCCACATTGTTTCGGTCTAA	310	20

Statistical analysis was conduct with SPSS version 12.0 to analyze the relationship between the frequency of PVL and mecA harboring species and the patient’s age and gender. Finally, Chi-square test was used to determine the statistical significance. In the current study, P values < 0.05 at 95% confidence interval were considered significant (2).

3. Results

In the current cross sectional study, 100 isolates of S. aureus were collected in 6 months. The isolates were collected from Al-Zahra, Kashani, and Shariati hospitals affiliated to Isfahan University of Medical Sciences. Based on the frequency of isolates detected from different departments of hospitals, orthopedics (%35.3) was the most infected department. The current study found a high prevalence of multi-drug resistant (MDR) S. aureus strains in hospitalized patients. Antibiotic resistance pattern of the studied isolates are shown in Table 2.

Table 2. Antibiotic Susceptibility Pattern of S. aureus Isolates^a

Antibiotic	Sensitive	Intermediate	Resistant
Penicillin	13.1	8	78.9
Imipenem	17.8	23	59.2
Cefazolin	24.3	30	45.7
Cefalotin	41.7	39	19.3
Ceftriaxone	29	10	61
Gentamicin	13	13.4	73.6
Ciprofloxacin	7	10	83
Clindamycin	15	56	29
Azithromycin	24.5	12.5	63
Erythromycin	3.8	23	73.2
Mupirocin	60.1	21.2	18.7
Rifampicin	49.9	32	18.1
Tetracycline	19.5	34.5	46
Trimethoprim	59	13	28
Vancomycin	90.8	7.2	2
Nitrofurantoin	81	7	12

^aValues are expressed as No. (%).

According to the result of the current study, out of 100 isolates, 56.2% were PVL positive of which 19.8% isolated from abscess, 51.7% from wound, 23.2% from bedsore, and 5.3% from tracheal secretion. Among the detected isolates, 87.8% were resistant to methicillin. Of the methicillin-resistant isolates, 80.2% harbored mecA gene; 69.2% were detected from females, and 30.8% from males. Due to increasing trend of drug resistance, further studies on larger sample sizes are necessary and can be useful to control hospital infections. The mean age of hospitalized patients that the isolates were taken from was 56 years, and according to the Student t test, there was no significant relationship between the age of patients and the presence of PVL gene, but there was a significant relationship between the detected genes and antibiotic resistance, especially resistance to methicillin.

4. Discussion

The results of the current study showed that 80.2% of all Staphylococcus strains harbored mecA coding resistance against methicillin. In addition to methicillin, the Staphylococcus strains showed resistant against some antibiotics such as macrolides, erythromycin, lincosamides, aminoglycosides, and tetracycline. Staphylococcus strains of the current investigation had the highest levels of antibiotic resistance against erythromycin (73.2%), ciprofloxacin (83%) and penicillin (78.9%). The lowest resistance rates were also against vancomycin (2%) and nitrofurantoin (12%).

The results of some other studies were in agreement with those of the current one, the frequency of PVL was 61% in a study by Alghaithy in

Saudi Arabia; Moussa in Jeddah showed that the majority of PVL-harboring S. aureus (n = 18; 39.1%) was isolated from soft tissue and wound infections. Moreover, the PVL gene was detected in patients with pneumonia and respiratory infections (n = 7; 25.0%); while, Rijals reported 56.1% in Bokhara, Tajikistan. The most commonly used antibiotics included oxacillin, nafcillin, and vancomycin and S. aureus strains showed the highest resistance to these bacteria in different reports (13-15).

Of the 100 isolates, 56.2% were PVL positive of which 19.8% were isolated from abscess, 51.7% from wound, 23.2% bed sore, and 5.3% from tracheal secretion. Among all of detected isolates, 87.8% were resistance to methicillin. However, the prevalence of this gene is report 65% amongst S. aureus isolates. These differences in the prevalence rate maybe due to different geographical areas and the type of assay used to detect the gene. Another study detected PVL in S. aureus using the agar gel immunodiffusion (AGID) test in a hospital in France and reported that the PVL-producing S. aureus isolates were responsible mostly for necrotizing cutaneous infections such as furuncle and abscess (16, 17).

It is noted in several reports that a patient with abscess, revolving furuncle, or wound infections should be primarily examined for PVL-producing S. aureus (18).

PVL-producing S. aureus is specifically detected in high-risk groups such as athletes. In the present study, Luks/f-PVL and mecA genes were detected using M-PCR and analyzed by electrophoresis on 1.5% gel agarose. The results were similar to those from other researches. The findings were in agreement with those from Wannet et al. in Holland (19). Generally, the results of the research showed the high prevalence of PVL-producing S. aureus in the hospitals under study. MRSAs are resistant to a wide range of antibiotics including methicillin; the result also reported in different studies (12).

5. Conclusions

Acknowledgements

Footnotes

References

1. Turlej A, Hryniewicz W, Empel J. Staphylococcal cassette chromosome mec (Sccmec) classification and typing methods: an overview. Pol J Microbiol. 2011;60(2):95-103. [PubMed: 21905625].
2. Nourbakhsh F, Namvar AE. Detection of genes involved in biofilm formation in Staphylococcus aureus isolates. GMS Hyg Infect Control. 2016;11:Doc07. doi: 10.3205/dgkh000267. [PubMed: 27303652].
3. Francis JS, Doherty MC, Lopatin U, Johnston CP, Sinha G, Ross T, et al. Severe community-onset pneumonia in healthy adults caused by methicillin-resistant Staphylococcus aureus carrying the Panton-Valentine leukocidin genes. Clin Infect Dis. 2005;40(1):100-7. doi: 10.1086/427148. [PubMed: 15614698].
4. Shahini Shams Abadi M, Nikokar I, Hoseini Alfatemi SM, Malekzadegan Y, Azizi A, Sedigh Ebrahim-Saraie H. Epidemiology of Panton-Valentine Leukocidin harbouring Staphylococcus aureus in cutaneous infections from Iran: a systematic review and meta-analysis. Infez Med. 2017;25(3):217-23. [PubMed: 28956538].
5. Sun L, Wu D, Chen Y, Wang Q, Wang H, Yu Y. Characterization of a PVL-negative community-acquired methicillin-resistant Staphylococcus aureus strain of sequence type 88 in China. Int J Med Microbiol. 2017;307(6):346-52. doi: 10.1016/j.ijmm.2017.07.002. [PubMed: 28734577].
6. Deinhardt-Emmer S, Sachse S, Geraci J, Fischer C, Kwetkat A, Dawczynski K, et al. Virulence patterns of Staphylococcus aureus strains from nasopharyngeal colonization. J Hosp Infect. 2017. doi: 10.1016/j.jhin.2017.12.011. [PubMed: 29253623].
7. Edslev SM, Clausen ML, Agner T, Stegger M, Andersen PS. Genomic analysis reveals different mechanisms of fusidic acid resistance in Staphylococcus aureus from Danish atopic dermatitis patients. J Antimicrob Chemother. 2017. doi: 10.1093/jac/dkx481. [PubMed: 29253168].
8. Ferraro MJ. Performance standards for antimicrobial susceptibility testing. NCCLS; 2001.
9. Morinaga N, Kaihou Y, Noda M. Purification, cloning and characterization of variant LukE-LukD with strong leukocidal activity of staphylococcal bi-component leukotoxin family. Microbiol Immunol. 2003;47(1):81-90. [PubMed: 12636257].
10. Boye K, Bartels MD, Andersen IS, Moller JA, Westh H. A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I-V. Clin Microbiol Infect. 2007;13(7):725-7. doi: 10.1111/j.1469-0691.2007.01720.x. [PubMed: 17403127].
11. Kawaguchiya M, Urushibara N, Kuwahara O, Ito M, Mise K, Kobayashi N. Molecular characteristics of community-acquired methicillin-resistant Staphylococcus aureus in Hokkaido, northern main island of Japan: identification of sequence types 6 and 59 Panton-Valentine leucocidin-positive community-acquired methicillin-resistant Staphylococcus aureus. Microb Drug Resist. 2011;17(2):241-50. doi: 10.1089/mdr.2010.0136. [PubMed: 21395449].
12. Nakaminami H, Ito A, Sakanashi D, Suematsu H, Yamagishi Y, Mikamo H, et al. Genetic diversity of pvl-positive community-onset methicillin-resistant Staphylococcus aureus isolated at a university hospital in Japan. J Infect Chemother. 2017;23(12):856-8. doi: 10.1016/j.jiac.2017.06.002. [PubMed: 28655502].
13. Alghaithy AA, Bilal NE, Gedebou M, Weily AH. Nasal carriage and antibiotic resistance of Staphylococcus aureus isolates from hospital and non-hospital personnel in Abha, Saudi Arabia. Trans R Soc Trop Med Hyg. 2000;94(5):504-7. [PubMed: 11132375].
14. Rijal KR, Pahari N, Shrestha BK, Nepal AK, Paudel B, Mahato P, et al. Prevalence of methicillin resistant Staphylococcus aureus in school children of Pokhara. Nepal Med Coll J. 2008;10(3):192-5. [PubMed: 19253865].
15. Moussa I, Kabli SA, Hemeg HA, Al-Garni SM, Shibl AM. A novel multiplex PCR for molecular characterization of methicillin resistant Staphylococcus aureus recovered from Jeddah, Kingdom of Saudi Arabia. Indian J Med Microbiol. 2012;30(3):296-301. doi: 10.4103/0255-0857.99490. [PubMed: 22885195].
16. Lina G, Piemont Y, Godail-Gamot F, Bes M, Peter MO, Gauduchon V, et al. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis. 1999;29(5):1128-32. doi: 10.1086/313461. [PubMed: 10524952].
17. Saeed K, Gould I, Espositio S, Ahmad-Saeed N, Ahmed SS, Alp E, et al. Panton-Valentine leukocidin-positive Staphylococcus aureus: a position statement from the International Society of Chemotherapy. Int J Antimicrob Agents. 2018;51(1):16-25. doi: 10.1016/j.ijantimicag.2017.11.002. [PubMed: 29174420].
18. Miklasevics E, Hæggman S, Balode A, Sanchez B, Martinsons A, Olsson-Liljequist B, et al. Report on the first PVL-positive community acquired MRSA strain in Latvia. Eurosurveillance. 2004;9(11):5-6. doi: 10.2807/esm.09.11.00485-en.
19. Wannet WJ, Spalburg E, Heck ME, Pluister GN, Tiemersma E, Willems RJ, et al. Emergence of virulent methicillin-resistant Staphylococcus aureus strains carrying Panton-Valentine leucocidin genes in The Netherlands. J Clin Microbiol. 2005;43(7):3341-5. doi: 10.1128/JCM.43.7.3341-3345.2005. [PubMed: 16000458].