Detection of Toxic Shock Syndrome Toxin (<i>tsst</i>) Gene Among <i>Staphylococcus aureus</i> Isolated from Patients and Healthy Carriers

Reza Hakimi Alni; Abdolmajid Mohammadzadeh; Pezhman Mahmoodi; Mohammad Yousef Alikhani

doi:10.5812/ajcmi.14249

Detection of Toxic Shock Syndrome Toxin (tsst) Gene Among Staphylococcus aureus Isolated from Patients and Healthy Carriers

Reza Hakimi Alni ¹ , Abdolmajid Mohammadzadeh ^{1 , *} , Pezhman Mahmoodi ¹ and Mohammad Yousef Alikhani ²

Authors Information

¹ Department of Pathobiology, Faculty of Veterinary Science, Bu-Ali Sina University, Hamadan, Iran

² Department of Microbiology, Faculty of Medicine, Hamadan University of Medical Sciences, Hamadan, Iran

Article information

Avicenna Journal of Clinical Microbiology and Infection: February 2018, 5 (1); e14249
Published Online: February 10, 2018
Article Type: Research Article
Received: May 30, 2017
Revised: December 3, 2017
Accepted: January 4, 2018
DOI: 10.5812/ajcmi.14249

To Cite: Hakimi Alni R, Mohammadzadeh A, Mahmoodi P, Alikhani M Y. Detection of Toxic Shock Syndrome Toxin (tsst) Gene Among Staphylococcus aureus Isolated from Patients and Healthy Carriers, Avicenna J Clin Microb Infec. 2018 ;5(1):e14249. doi: 10.5812/ajcmi.14249.

Abstract

Copyright © 2018, Avicenna Journal of Clinical Microbiology and Infection. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited

1. Background

Staphylococcus aureus is the main etiological agent of various diseases, including skin and soft-tissue infections (SSTIs), endovascular infections, urinary tract infections (UTIs), bacteremia, and sepsis in both hospitalized and non-hospitalized humans, which is frequently reported from different parts of the world (1).

One of the important prerequisites of infections by these bacteria is its ability to establish a human commensal. Staphylococcusaureus is commonly resident in anterior nares of people. It has been reported that 10% to 40% of the population carries this organism (2). Nasal carriers are more susceptible to nosocomial infections than non-carrier individuals and increased risk of infection with these bacteria has been documented in patients with end-stage renal failure after surgery (3).

Staphylococcus aureus produces a wide variety of exoproteins that contribute to its pathogenicity. However, only a small number of its isolates produce additional exoproteins, such as Toxic Shock Syndrome Toxin (TSST), which belongs to pyrogenic toxin superantigens (PTSAgs) (4). Furthermore, TSST is a protein with 22-kD molecular weight, which is encoded by the tsst gene (5). This protein affects cells of the immune system and stimulates release of interleukin-1, interleukin-2, tumor necrosis factor-alpha (TNF-a) and nonspecific T cell proliferation, which may lead to a severe and potentially fatal disease in humans, known as toxic shock syndrome (TSS) (6-8).

2. Objectives

3. Methods

3.1. Isolation of Staphylococcus aureus

The present cross-sectional study was performed on S. aureus isolated from patients and healthy carriers. Also, useful data, including gender, age, and tobacco use were collected through a questionnaire from these people.

Patients: forty S. aureus isolates were obtained from different clinical samples (skin, tracheal tube, blood, urine, and sputum) of individuals referred to Shahid Beheshti hospital of Hamadan for a period of 9 months from January 2014 to September 2015. These isolates were identified based on common biochemical tests.

Healthy carriers: overall, 100 specimens were collected from nasal cavity of healthy carriers, who worked in dairy farms using sterile cotton swabs moistened in sterile normal saline. Age, gender, and previous tobacco usage among all of the sampled people were also recorded to see if these characteristics had a relationship with S. aureus carriage. The tips of the swabs were placed in a tube (containing 1 mL of phosphate-buffered saline) and 100 µL of this suspension was spread onto mannitol salt agar medium followed by incubation at 37°C for 48 hours (which resulted in the isolation of 20 S. aureus isolates).

Finally, all of the isolates (n = 60) were molecularly confirmed to be S. aureus, using a species-specific Polymerase Chain Reaction (PCR) (data are not shown).

3.2. Extraction of DNA Samples

Bacterial DNA was extracted from an overnight tryptic soy broth (TSB, Merck) culture of each isolate using the phenol-chloroform method (9).

3.3. Polymerase Chain Reaction Amplification of the tsst Gene

The target sequence of tsst gene was amplified by PCR using primers, which have been previously reported by Mehrotra et al. (Table 1) (10). The total reaction volume (25 µL) contained 2.5 µL of 10X PCR buffer (500 mM, KCL and Tris HCL, pH 8.4), 0.5 µL (12.5 mM) MgCl₂, 0.5 µL (200 mM) dNTPs, 0.5 µL (50 pmol) of each primer (SinaClon, Iran), 3.5 µL (120 ng) of extracted DNA, 17 µL distilled water, and 1 U of Taq DNA polymerase (SinaClon, Iran). The PCR amplification was performed under the following conditions: initial denaturation at 95°C for 6 minutes followed by denaturation at 95°C for 1 minute, annealing at 55°C for 35 seconds and extension at 72°C for 1:30 minutes (32 cycles) and a final extension at 72°C for 10 minutes. After amplification, the PCR products were analyzed by electrophoresis on 1.5% agarose gel containing ethidium bromide (0.5 µg/mL).

Table 1. Primers Used for Amplification of the tsst Gene

Primer	Sequence 5’ - 3’	Product size, bp
tsst-forward	ACCCCTGTTCCCTTATCATC	326
tsst-reverse	TTTTCAGTATTTGTAACGCC	326

3.4. Cefoxitin Disk Diffusion Method to Detect Methicillin-Resistant Strains

In the author’s previous study, methicillin susceptible isolates were tested by the disk diffusion method using oxacillin disk (Merck, Germany), and the mecA gene (methicillin resistance gene) was identified (11). In the present study, sensitive strains to methicillin were confirmed by cefoxitin disk diffusion method (12).

3.5. Statistical Analysis

The results were compared by Chi-square test using the SPSS software, and P < 0.05 was considered statistically significant.

4. Results

Patients: a total of 40 S. aureus were isolated from the patients (30% from skin, 27.5% from trachea, 25% from urine, 10% from blood, and 7.5% from sputum). The number of S. aureus isolated from males (67.5%) was more than that from females, and this was statistically significant (P = 0.02). Besides, most of these isolates (67.5%) belonged to people aged over 50 years old and the statistical analysis showed that there was a significant difference in the isolation of S. aureus in various age groups (P = 0.02). However, no difference was observed between tobacco usage and isolation of these bacteria. In addition, the results of cefoxitin disk diffusion method, except in two cases, were the same as the results of oxacillin disk diffusion method, to detect methicillin-resistant isolates.

As shown in Figure 1, tsst amplicon of the expected size (326 bp) was detected for some of the patients’ and carriers’ isolates. Altogether, 9 out of 40 S. aureus patients’ isolates (22.5%) were found to be positive for the tsst gene. All of the tsst positive isolates were methicillin-resistant Staphylococcus aureus (MRSA) strains except one that was a methicillin-sensitive Staphylococcus aureus (MSSA) isolate. Detailed data about isolated S. aureus from the patients and carriers are presented in Tables 2 and 3.

Figure 1. Electrophoresis of the Polymerase Chain Reaction Products Obtained from Amplification of the tsst Gene

Lane 1, a tsst positive strain (S. aureus ATCC 25923); Lane 2, negative control (contained no template DNA); Lanes 3 - 6, S. aureus isolates, which were positive for tsst gene; Lane L, a 100 bp DNA ladder.

Table 2. Number of Staphylococcus Aureus Isolated from Patients

Sample type	No. of Isolates	No. of MRSA	Gender		Age			Tobacco Usage	tsst Positive
			Male	Female	30 >	30 - 50	50 <
Skin	12	7	8	4	2	4	6	1	2
Trachea	11	11	7	4	1	0	10	2	2
Urine	10	10	5	5	1	2	7	0	2
Blood	4	4	4	0	0	3	1	0	2
Sputum	3	2	3	0	0	0	3	1	1
Total	40	34	27	13	4	9	27	4	9

Table 3. Number of Staphylococcus Aureus Isolated from Healthy Carriers

Gender	No. of Samples	No. of Isolates	No. of MRSA	Age (Positive Carriers)			Tobacco Usage	tsst Positive
				30 >	30 - 50	50 <
Male	90	20	1	3	12	5	7	9
Female	10	0	0	0	0	0	0	0
Total	100	20	1	3	12	5	7	9

Carriers: twenty S. aureus were isolated from 100 collected nasal swabs. Unlike patients’ isolates, the majority of carriers’ isolates (60%) belonged to people aged between 30 and 50 years old. Moreover, 7 isolates (35%) belonged to smokers and Chi-square test revealed that this was statistically significant (P = 0.01). The numbers of S. aureus isolated from the 2 groups of individuals (patients and carriers) are compared in Figure 2 based on each category.

Figure 2. Comparison Chart of Patients’ and Carriers’ Isolates

The results of PCR assay for 20 S. aureus isolated from nasal cavity of healthy carriers indicated that 9 isolates were positive for the tsst gene (Figure 1). Nevertheless, unlike patients’ isolates, none of these isolates were an MRSA strain. According to the results, the proportion of tsst-positive isolates in carriers (45%) was significantly higher with respect to the patients (22.5%) (P = 04).

5. Discussion

Staphylococcus aureus is a common cause of nosocomial and community-associated infections. Diseases with these bacteria increase length of hospital stay, antibiotic use, costs, and mortality. Besides, some of S. aureus strains are MRSA, which are known as the most prevalent antimicrobial resistant bacteria isolated in various continents, including Americas, North Africa, Europe, and the Middle- and Far East (13). Fluit et al. reported that S. aureus was the most common causative agent of nosocomial pneumonia, and skin and soft tissue infections (1). In the present study, the percentages of isolated S. aureus from skin and trachea were higher than the other samples. However, a high percentage of the isolated bacteria also belonged to urine samples. Furthermore, 65% of patients’ isolates belonged to elderly suggesting that old people may be at higher risk of infection with these bacteria. In this case, Kang et al. indicated that nosocomial infections with S. aureus were more prevalent in the elderly group (14) and the current finding was in agreement with this result. However, some researchers found no significant difference between isolated bacteria and age of the patients (15).

On the other hand, nasal carriage is a risk factor for acquiring nosocomial infection. Von Eiff et al. reported that nosocomial S. aureus bacteremia in carriers was attributable as an endogenous source (16). Therefore, elimination of S. aureus from nasal carriers is of great help in controlling such diseases. Kluytmans et al. showed that using mupirocin nasal ointment may lead to significant reduction in the rate of surgical-wound infections (17). Some researchers also reported that elimination of S. aureus nasal carriage with mupirocin may result in disappearance of these bacteria from the other areas of the body (18, 19). HU et al. indicated that many factors, including deformities of the nasal cavity, genetic influences, and bacterial interference, are involved in the colonization of S. aureus in the nasal cavity (2). In the current study, the rate of occurrence of S. aureus in the nasal cavity of healthy people was 20%, which is somewhat similar to that reported by other researchers, who indicated that carriage rates in the Netherlands was about 24% (3, 20). From another perspective, this is an important issue as the sampled carriers were those who worked in dairy farms and it was previously shown that S. aureus isolated from milk samples may also be tsst positive indicating the possibility of the transfer of these bacteria between humans and animals (21).

Regarding the important role of TSS toxin in septic shock, the present study was performed to detect tsst gene among S. aureus isolated from patients and healthy carriers. The results of the PCR assay demonstrated that 22.5% of patients’ isolates contained the tsst gene. These tsst-positive S. aureus were isolated from samples of different origins. However, the results also revealed that the percentage of tsst-positive isolates in carrier individuals was almost 2 folds (45%) higher than that for patients, and this difference was statistically significant (P = 0.04).

Different numbers of tsst-positive S. aureus have been reported in previous studies. Using the PCR method, El-Ghodban et al. recorded that only 3 out of 40 S. aureus isolated from clinical sources possessed the tsst gene (22). Mehrotra et al. examined 107 S. aureus isolated from healthy carriers to determine tsst positive samples and showed that 24.3% possessed this gene (10). Also many studies have been conducted on the presence of tsst gene in S. aureus isolates from Iran. Kord and Amini analyzed 76 S. aureus strains isolated from clinical samples. Their results showed that only 8.95% of isolates were positive for the tsst gene (23). In another study, performed on 100 MRSA and 100 MSSA isolates in Hamadan, the prevalence of TSST-1 was 11% (24). The current results showed that the frequency of tsst gene (30%) in Hamadan was more than that in other areas of Iran. Meanwhile, the results of the present study were in agreement with previous findings, which indicated that many S. aureus isolated from carriers contained the tsst gene (25).

Although several researchers have reported that tsst gene was more prevalent in MRSA than MSSA strains (26, 27), this study indicated that tsst gene was more prevalent in MSSA strains suggesting that MSSA strains must also be considered as potential risk of TSS in humans.

5.1. Conclusion

The results of the present study revealed that a high proportion of all S. aureus isolates (18 out of 60 isolates; 30%) possessed the tsst gene. This should be considered as a major health concern as such isolates may circulate among humans, animals, and environment. Hence, appropriate hygienic measures should be taken to control and prevent such infections.

Acknowledgements

References

1. Fluit AC, Schmitz FJ, Verhoef J, European SPG. Frequency of isolation of pathogens from bloodstream, nosocomial pneumonia, skin and soft tissue, and urinary tract infections occurring in European patients. Eur J Clin Microbiol Infect Dis. 2001;20(3):188-91. [PubMed: 11347669].
2. Hu L, Umeda A, Kondo S, Amako K. Typing of Staphylococcus aureus colonising human nasal carriers by pulsed-field gel electrophoresis. J Med Microbiol. 1995;42(2):127-32. doi: 10.1099/00222615-42-2-127. [PubMed: 7869348].
3. Wertheim HF, Vos MC, Ott A, van Belkum A, Voss A, Kluytmans JA, et al. Risk and outcome of nosocomial Staphylococcus aureus bacteraemia in nasal carriers versus non-carriers. Lancet. 2004;364(9435):703-5. doi: 10.1016/S0140-6736(04)16897-9. [PubMed: 15325835].
4. Marrack P, Kappler J. The staphylococcal enterotoxins and their relatives. Science. 1990;248(4956):705-11. [PubMed: 2185544].
5. Ruzin A, Lindsay J, Novick RP. Molecular genetics of SaPI1--a mobile pathogenicity island in Staphylococcus aureus. Mol Microbiol. 2001;41(2):365-77. [PubMed: 11489124].
6. Ikejima T, Okusawa S, van der Meer JW, Dinarello CA. Induction by toxic-shock-syndrome toxin-1 of a circulating tumor necrosis factor-like substance in rabbits and of immunoreactive tumor necrosis factor and interleukin-1 from human mononuclear cells. J Infect Dis. 1988;158(5):1017-25. [PubMed: 3263446].
7. Takeuchi S, Ishiguro K, Ikegami M, Kaidoh T, Hayakawa Y. Production of toxic shock syndrome toxin by Staphylococcus aureus isolated from mastitic cow's milk and farm bulk milk. Vet Microbiol. 1998;59(4):251-8. [PubMed: 9556857].
8. Crass BA, Bergdoll MS. Toxin involvement in toxic shock syndrome. J Infect Dis. 1986;153(5):918-26. [PubMed: 3701106].
9. Wilson K. Preparation of genomic DNA from bacteria. Curr Protoc Mol Biol. 2001;Chapter 2:2-4. doi: 10.1002/0471142727.mb0204s56. [PubMed: 18265184].
10. Mehrotra M, Wang G, Johnson WM. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. J Clin Microbiol. 2000;38(3):1032-5. [PubMed: 10698991].
11. Hakimi Alni R, Mohammadzadeh M, Mahmoodi P, Alikhani MY. RAPD-PCR analysis of Staphylococcus aureus strains isolated from different sources. Comp Clin Path. 2017;26(4):823–30.
12. Jain A, Agarwal A, Verma RK. Cefoxitin disc diffusion test for detection of meticillin-resistant staphylococci. J Med Microbiol. 2008;57(Pt 8):957-61. doi: 10.1099/jmm.0.47152-0. [PubMed: 18628495].
13. Sollid JU, Furberg AS, Hanssen AM, Johannessen M. Staphylococcus aureus: determinants of human carriage. Infect Genet Evol. 2014;21:531-41. doi: 10.1016/j.meegid.2013.03.020. [PubMed: 23619097].
14. Kang CI, Song JH, Ko KS, Chung DR, Peck KR, Asian Network for Surveillance of Resistant Pathogens Study G. Clinical features and outcome of staphylococcus aureus infection in elderly versus younger adult patients. Int J Infect Dis. 2011;15(1):58-62. doi: 10.1016/j.ijid.2010.09.012. [PubMed: 21111647].
15. Goudarzi M, Seyedjavadi SS, Goudarzi H, Boromandi S, Ghazi M, Azad M, et al. Characterization of coagulase negative staphylococci isolated from hospitalized patients in Tehran, Iran. J Paramed Sci. 2014;5(2):44-50. doi: 10.22037/jps.v5i2.5841.
16. von Eiff C, Becker K, Machka K, Stammer H, Peters G. Nasal carriage as a source of Staphylococcus aureus bacteremia. Study Group. N Engl J Med. 2001;344(1):11-6. doi: 10.1056/NEJM200101043440102. [PubMed: 11136954].
17. Kluytmans JA, Mouton JW, Ijzerman EP, Vandenbroucke-Grauls CM, Maat AW, Wagenvoort JH, et al. Nasal carriage of Staphylococcus aureus as a major risk factor for wound infections after cardiac surgery. J Infect Dis. 1995;171(1):216-9. [PubMed: 7798667].
18. Reagan DR, Doebbeling BN, Pfaller MA, Sheetz CT, Houston AK, Hollis RJ, et al. Elimination of coincident Staphylococcus aureus nasal and hand carriage with intranasal application of mupirocin calcium ointment. Ann Intern Med. 1991;114(2):101-6. [PubMed: 1898585].
19. Holton DL, Nicolle LE, Diley D, Bernstein K. Efficacy of mupirocin nasal ointment in eradicating Staphylococcus aureus nasal carriage in chronic haemodialysis patients. J Hosp Infect. 1991;17(2):133-7. [PubMed: 1674259].
20. Lebon A, Moll HA, Tavakol M, van Wamel WJ, Jaddoe VW, Hofman A, et al. Correlation of bacterial colonization status between mother and child: the Generation R Study. J Clin Microbiol. 2010;48(3):960-2. doi: 10.1128/JCM.01799-09. [PubMed: 19940045].
21. Baniardalan S, Mohammadzadeh A, Pajohi alamoti M, Mahmoodi P, Sadeghinasab A. Detection of toxic shock toxin, (TST) gene in Staphylococcus aureus isolated from bovine milk samples. Bulg J Vet Med. 2017;20(3):236-43. doi: 10.15547/bjvm.1007.
22. El Ghodban A, Ghenghesh KS, Marialigeti K, Esahli H, Tawil A. PCR detection of toxic shock syndrome toxin of staphylococcus aureus from Tripoli, Libya. J Med Microbiol. 2006;55(2):179-82. doi: 10.1099/jmm.0.46162-0. [PubMed: 16434710].
23. Kord Z, Amini K. Determining genesseh, TSST-1, can and antibiotic resistance in staphylococcus aureus strainsisolated from clinical specimens. J Ilam Univ Med Sci. 2016;24(3):31-9.
24. Arabestani MR, Rastiany S, Mousavi SF, Ghafel S, Alikhani MY. Identification of toxic shock syndrom and exfoliative toxin genes of staphylococcus aureus in carrier persons, resistant and susceptible methicillin. Tehran Univ Med J. 2015;73(8):554-60.
25. Chance TD. Toxic shock syndrome: role of the environment, the host and the microorganism. Br J Biomed Sci. 1996;53(4):284-9. [PubMed: 9069106].
26. Kimura A, Igarashi H, Ushioda H, Okuzumi K, Kobayashi H, Otsuka T. [Epidemiological study of Staphylococcus aureus isolated from the Japanese National University and Medical College Hospitals with coagulase typing, and production of enterotoxins and toxic shock syndrome toxin-1]. Kansenshogaku Zasshi. 1992;66(11):1543-9. [PubMed: 1294655].
27. Shimaoka M, Yoh M, Takarada Y, Yamamoto K, Honda T. Detection of the gene for toxic shock syndrome toxin 1 in Staphylococcus aureus by enzyme-labelled oligonucleotide probes. J Med Microbiol. 1996;44(3):215-8. doi: 10.1099/00222615-44-3-215. [PubMed: 8636940].