Staphylococcal Cassette Chromosome mec (SCCmec) Typing of Methicillin-Resistant Staphylococcus aureus Strains Isolated from Community- and Hospital-Acquired Infections

Fahimeh Ghanbari; Shirin Saberianpour; Fatemeh-sadat Zarkesh-Esfahani; Nafiseh Ghanbari; Azadeh Taraghian; Farzad Khademi

doi:10.5812/ajcmi.42244

Staphylococcal Cassette Chromosome mec (SCCmec) Typing of Methicillin-Resistant Staphylococcus aureus Strains Isolated from Community- and Hospital-Acquired Infections

Fahimeh Ghanbari ¹ , Shirin Saberianpour ² , Fatemeh-sadat Zarkesh-Esfahani ³ , Nafiseh Ghanbari ⁴ , Azadeh Taraghian ⁵ and Farzad Khademi ^{6 , *}

Authors Information

¹ Student Research Committee, School of Medicine, Shahid Saddoghi University of Medical Sciences, Yazd, Iran

² Department of Molecular Medicine, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences, Tabriz, Iran

³ Department of Microbiology, Faculty of Bioscience, Falavarjan Branch Islamic Azad University, Falavarjan, Isfahan, Iran

⁴ Department of Biology, Science and Art University, Yazd, Iran

⁵ Department of Microbiology, School of Medicine, Esfahan University of Medical Sciences, Esfahan, Iran

⁶ Department of Microbiology, School of Medicine, Ardabil University of Medical Sciences, Ardabil, Iran

Article information

Avicenna Journal of Clinical Microbiology and Infection: May 2017, 4 (2); e42244
Published Online: April 23, 2017
Article Type: Research Article
Received: September 12, 2016
Revised: December 18, 2016
Accepted: December 27, 2016
DOI: 10.5812/ajcmi.42244

To Cite: Ghanbari F, Saberianpour S, Zarkesh-Esfahani F, Ghanbari N, Taraghian A, et al. Staphylococcal Cassette Chromosome mec (SCCmec) Typing of Methicillin-Resistant Staphylococcus aureus Strains Isolated from Community- and Hospital-Acquired Infections, Avicenna J Clin Microb Infec. 2017 ;4(2):e42244. doi: 10.5812/ajcmi.42244.

Abstract

Copyright © 2017, Hamadan University of Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

1. Background

Staphylococcus aureus (S. aureus) is a major human pathogen, responsible for both community- and hospital-acquired infections worldwide. Methicillin resistance is induced by mecA gene, which is located on the staphylococcal cassette chromosome mec (SCCmec), a large heterologous genetic element, encoding a low-affinity penicillin-binding protein 2a (PBP2a), which inhibits the activity of β-lactam antibiotics (1-3).

The increasing prevalence of methicillin-resistant S. aureus (MRSA) complicates the treatment and management of staphylococcal infections (4). Therefore, MRSA screening is extremely important for epidemiological surveillance in order to prevent the spread of MRSA infections. To classify MRSAs, it is necessary to understand their genetic structure and detect all SCCmec types (2, 5). Although conventional MRSA typing techniques are not adequate for epidemiological surveys, numerous molecular techniques are available for this purpose (6, 7).

SCCmec typing is a polymerase chain reaction (PCR)-based method, which is essential for characterization of MRSA clones in epidemiological studies and provides important information about the mobile genetic elements of methicillin resistance (8, 9). SCCmec is an element involved in the horizontal transfer of resistant genes among Staphylococcus strains. It is also a marker for differentiation between hospital-acquired methicillin-resistant (HA-MRSA) and community-acquired methicillin-resistant (CA-MRSA) strains (10-12).

MRSA SCCmec elements have been classified into 5 different allotypes and sometimes show poor discriminatory power (12, 13). SCCmec types I, II, and III are usually found in HA-MRSA and multidrug-resistant (MDR) strains, whereas CA-MRSA strains are mostly associated with SCCmec type IV or V (14, 15).

2. Objectives

3. Methods

3.1. Bacterial Strains and Phenotypic Test

A total of 100 S. aureus strains were isolated from inpatients and outpatients, admitted to Al-Zahra Hospital of Isfahan, Iran during January-June, 2015. The isolates were obtained from different clinical specimens, including wounds, blood samples, urine samples, and abscesses. S. aureus isolates were identified through culture studies, as well as morphological and conventional biochemical tests, including Gram staining, catalase test, mannitol fermentation, slide coagulase test, tube coagulase test, and DNase test. Then, the isolates were classified as CA-MRSA or HA-MRSA, based on the recorded data of the patients. Hospital-acquired infection was defined as bacterial colonization after more than 48 hours of hospitalization.

3.2. Antimicrobial Susceptibility Test

The susceptibility of S. aureus isolates to antimicrobial agents was determined by disk diffusion method on Mueller-Hinton agar medium, according to the clinical and laboratory standards institute (CLSI) guidelines (16). The used antibiotics were as follows: vancomycin (30 μg), tetracycline (30 μg), gentamicin (10 μg), clindamycin (2 μg), ciprofloxacin (5 μg), rifampin (30 μg), cefoxitin (30 μg), levofloxacin (5 μg), and cotrimoxazole (25 μg) (HiMedia, India). Inducible macrolide-lincosamide-streptogramin B resistance was identified as the flat zone of clindamycin growth inhibition near the erythromycin disk (D-shaped). S. aureus strain ATCC25923 was used for the quality control of antibiotic susceptibility test.

3.3. Phenotypic Detection of MRSA Isolates

All S. aureus isolates were screened for oxacillin resistance, using agar screening method. Resistance to methicillin was defined as the growth capacity in the agar screening medium, including 4% NaCl and 8 μg/mL of oxacillin (Sigma, USA). Also, S. aureus ATCC 25923 was used as the control.

3.4. Genotypic Detection of mecA Gene

For this purpose, DNA extraction was performed for all the isolates, which were grown overnight on nutrient agar at 37°C, using the K0512 DNA kit (Fermentas, Germany) in accordance with the manufacture’s instructions. Using specific primers listed in Table 1, amplification of the 583-bp fragment of mecA gene was performed through PCR.

Table 1. Primers Used in the Present Study

Target	Primer	Sequence	Product Size (bp)	Reference
mecA	F	AAAATCGATGGTAAAGGTTGGC	583	(17)
mecA	R	AGTTCTGCAGTACCGGATTTG	583	(17)
SCCmec	βF	ATTGCCTTGATAATAGCCYTCT	937	(18)
	α3R	TAAAGGCATCAATGCACAAACACT	937
	ccrCF	CGTCTATTACAAGATGTTAAGGATAATCCTTTA	518
	ccrCR	TAGACTGGATTATTCAAAATAT	518
	1272F1	GCCACTCATAACATATGGAA	1415
	1272R1	CATCCGAGTGAAACCCAAA	1415
	5RmecA	TATACCAAACCCGACAACTAC	359
	5R431	CGGCTACAGTGATAACATCC	359

The amplification reaction mixture (25 μL) contained 4 µL of DNA template, 2.5 µL of PCR buffer (10X), 0.75 µL of MgCl2 (50 mM), 0.5 µL of deoxynucleotide triphosphates (dNTPs, 10 mM), 1 µL of each primer (2 μL in total), 0.25 µL of Ex-Taq DNA polymerase (5 u/µL), and 15 µL of distilled water. PCR conditions were as follows: initial denaturation at 94°C for 5 minutes, 30 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 30 seconds, and final extension at 72°C for 7 minutes.

3.5. Multiplex PCR for SCCmec Typing

SCCmec typing for 54 MRSA isolates was performed via multiplex PCR method. Primers shown in Table 1 were used for this purpose. Each PCR round was performed in a final volume of 25 µL, consisting of 4 µL of DNA template, 2.5 µL of PCR buffer (10X), 0.75 µL of MgCl2 (50 mM), 0.5 µL of dNTPs (10 mM), 0.5 µM of βF1, α3R1, ccrR, and ccrF primers, 0.3 µM of 1272F1, 1272R1, 5RmecA, and 5R431 primers (3.2 μL in total), 0.25 µL of Ex-Taq DNA polymerase (5 u/µL), and 13.8 µL of distilled water.

DNA was amplified with a thermocycler (Eppendorf, Germany), and multiplex PCR conditions were as follows: initial denaturation at 94°C for 4 minutes, 35 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 60 seconds, and final extension at 72°C for 10 minutes.

4. Results

During 6 months, 100 S. aureus isolates from various clinical specimens were collected from Al-Zahra Hospital of Isfahan. The isolates were obtained from urinary tract infections (UTIs) (n = 23, 23%), blood samples (n = 21, 21%), wounds (n = 20, 20%), abscesses (n = 14, 14%), and other samples (n = 22, 22%). The rate of isolation in females and males was 62 (62%) and 38 (38%), respectively. The patients’ average age was 47 years (range, < 1 - 89 years).

Antimicrobial susceptibility test was performed via disk diffusion method. The results showed that S. aureus resistance to cefoxitin (54%) was the highest resistance rate, followed by tetracycline (52%), gentamicin (30%), clindamycin (29%), ciprofloxacin (20%), rifampin (19%), cotrimoxazole (10%), and levofloxacin (10%). The results indicated that all the isolates were sensitive to vancomycin. Also, inducible resistance to clindamycin was found in 2 isolates.

In the present study, presence of mecA gene in all the isolates was evaluated, using the oxacillin agar screening method and confirmed by molecular methods. The results showed that 54 (54%) isolates were identified as MRSA, using the agar screening method (phenotypic detection). Overall, 13 (24.07%) out of 54 isolates were obtained from wounds, 10 (18.51%) from blood, 8 (14.81%) from UTI samples, 6 (11.11%) from abscesses, 5 (9.25%) from trachea, and 12 (22.22%) from other samples.

In this study, we collected 42 (77.7%) MRSA isolates from inpatients (HA-MRSA) and 12 (22.23) isolates from outpatients (CA-MRSA). The patients with CA-MRSA were younger than those with HA-MRSA. Among 100 strains tested with PCR (genotypic detection), 54% were positive for mecA gene. Finally, to determine the SCCmec type of MRSA isolates, SCCmec typing was evaluated among S. aureus isolates. As the findings revealed, 19 (35.18%), 13 (24.7%), 6 (11.11%), 5 (9.25%), and 3 (5.55%) MRSA isolates contained SCCmec type III, type I, type IV, type II, and type V, respectively; also, 8 isolates (14.81%) were nontypable.

Table 2. Antimicrobial Susceptibility Test

Antibiotics	Susceptibility, Number of Isolates (%)
	Susceptible		Intermediate		Resistant
	No.	%	No.	%	No.	%
Ciprofloxacin	66	66	14	14	20	20
Vancomycin	100	100	0	0	0	0
Gentamicin	60	60	10	10	30	30
Clindamycin	66	66	5	5	29	29
Tetracycline	43	43	5	5	52	52
Levofloxacin	82	82	8	8	10	10
Rifampin	76	76	5	5	19	19
Cefoxitin	42	42	4	4	54	54
Cotrimoxazole	87	87	3	3	10	10

5. Discussion

Today, MRSA is one of the most frequent nosocomial pathogens worldwide (19). The rate of antibiotic resistance, including methicillin resistance, is high in developing countries such as Iran, which might be due to the uncontrolled high rate of antibiotic prescription. The mean incidence of MRSA infections in Iranian hospitals has been reported to be 52.7% ± 4.7 (20). Overall, CA-MRSA infections occurred in healthy individuals outside healthcare settings without any risk factors and could act as a source of transfer to community.

On the other hand, recent studies have demonstrated that the epidemiology of MRSA has changed, and CA-MRSA strains are now being introduced into the hospital setting. Detection of the epidemiology, clinical syndrome, and antibiotic resistance of possible CA-MRSA allows early initiation of treatment and control measures (21, 22). The prevalence of HA-MRSA in the present study was 77.7% (n = 42), which is high. In this regard, Stranden et al. and Moghadami et al. (14, 23) have reported similar findings.

As presented in Table 2, based on the antimicrobial susceptibility profile in the current study, the highest resistance of S. aureus isolates was reported against cefoxitin (54%), oxacillin (54%), and tetracycline (52%), followed by gentamicin (30%), clindamycin (29%), ciprofloxacin (20%), rifampicin (19%), cotrimoxazole (10%), and levofloxacin (10%). Incidentally, all the isolates were susceptible to vancomycin in the present study. These rates were lower than those reported by Moghadam et al. and Ghasemian et al. (24, 25).

In the present study, 16% of MRSA isolates were MDR, which is the main cause of failure in antibiotic therapy and increasing cost of treatment for patients and healthcare systems throughout the world (20). The phenotypic methods for MRSA detection are simple and relatively cost-effective, although they are subjected to variations in environmental conditions, such as incubation time, medium pH, and inoculum size. The associated drawbacks are among several reasons for replacing these methods with molecular ones, which are accurate and have good reproducibility (12).

Detection of mecA gene in the present study by PCR method revealed that phenotypic and genotypic methods produce similar results regarding the susceptibility of S. aureus to methicillin (MRSA). The present study showed that the prevalence of resistant strains to methicillin has steadily increased in comparison with a previous study performed in the same hospital (20% vs. 54%) (5, 26). Furthermore, a similar prevalence rate (54%) was reported by Moghadami et al. in Shiraz, Iran (21). In contrast, Ghasemian et al. reported a prevalence rate of 25% in Tehran in 2015, and Orrett et al. showed a prevalence rate of 20.8% from nosocomial sources in Trinidad (3).

Based on SCCmec typing, MRSA strains are classified into 5 different allotypes, 2 of which have been identified in Asian countries. The clonotype II is distributed in Japan and Korea, whereas clonotype III is predominant in some other Asian countries, such as Saudi Arabia, India, China, and Thailand (8, 27, 28). We used SCCmec typing to monitor the epidemiology of MRSA isolates, collected from hospital- and community-acquired infections. Distribution of SCCmec types among S. aureus isolates demonstrated that 19 (35.18%), 13 (24.07%), 6 (11.11%), 5 (9.25%), and 3 (5.55%) strains harbored SCCmec type III, type I, type IV, type II, and type V, respectively; however, 8 (14.81%) strains were nontypable (Figure 3).

Figure 1. Agarose gel electrophoresis of mecA genes as PCR amplification products. Lane 1, positive control (S. aureus ATCC33591); lane 2 - 8, positive mecA sample (583 bp); and lane 9, 100-bp DNA ladder.

Figure 2. Agarose gel electrophoresis of SCCmec genes as the multiplex PCR amplification products in MRSA isolates. Lane 1, SCCmec type II (937 bp); lane 3, 4, 5 and 9, SCCmec type III (518 bp); lane 6, SCCmec type I (415 bp); lane 7, SCCmec type V (518 and 359 bp); lane 10, 50-bp DNA ladder; and lane 11, SCCmec type IV (415 and 937 bp).

Figure 3. SCCmec Typing of MRSA Isolated Separately from Community and Hospital Setting

Similar findings in agreement with the present study have been reported by Japoni et al., while contradictory results have been reported by Pe’rez-Va’zquez et al., Chongtrakool et al., and Chongtrakool et al. (29). While SCCmec type III (35.18%) showed the highest prevalence in the present study, frequency of SCCmec type V (5.55%) was low. These results were consistent with previous studies performed in Iran and other countries (24, 27, 30, 31).

As expected, SCCmec types V and IV have been overrepresented among MRSA strains, isolated from community-acquired infections. Only 2 isolates with SCCmec type IV belonged to HA-MRSA, while SCCmec types I, II, and III were associated with MRSA strains, isolated from hospital-acquired infections (HA-MRSA) (5, 14). In the present study, SCCmec typing did not show 100% typeability and had poor discriminatory power, as 8 (8%) MRSA isolates were nontypable (32).

Distribution of the isolates on the basis of the specimen source revealed that 75% of MRSA strains with SCCmec type III (as the predominant SCCmec type) were obtained from blood samples, which is consistent with several previous studies (27, 33). Overall, these findings propose that antibiotic pressure and lack of standard control measures might be responsible for the increased prevalence of MRSA in Al-Zahra hospital in comparison with the previous study in this hospital. Also, frequent screening of susceptibility patterns of MRSA can be useful in decreasing the incidence rates.

Finally, it appears that SCCmec typing provides useful information for determining the epidemiological relationship of a group of MRSA isolates, recovered from hospitals and/or community in Iran. To determine the exact antimicrobial susceptibility profiles and encoding resistance genes among MRSA isolates in the community and hospital settings of Iran, comprehensive research and large-scale studies are needed to provide further information on the phenotypic and genotypic characteristics of MRSA. Also, effective infection management for controlling the spread of CA-MRSA infections is highly recommended.

It should be noted that the positive control strains for SCCmec typing were donated by Amir Azimian (department of pathobiology and anatomy, school of medicine, North Khorasan University of Medical Sciences, Bojnord, Iran).

Acknowledgements

Footnotes

References

1. Han JH, Edelstein PH, Lautenbach E. Reduced vancomycin susceptibility and staphylococcal cassette chromosome mec (SCCmec) type distribution in methicillin-resistant Staphylococcus aureus bacteremia. J Ant Chemother. 2012; : 1-4
2. Francois P, Renzi G, Pittet D, Bento M, Lew D, Harbarth S, et al. A novel multiplex real-time PCR assay for rapid typing of major staphylococcal cassette chromosome mec elements. J Clin Microbiol. 2004; 42(7): 3309-12[DOI][PubMed]
3. Orrett FA, Land M. Methicillin-resistant Staphylococcus aureus prevalence: Current susceptibility patterns in Trinidad. BMC Infect Dis. 2006; 6(6): 1-6
4. Duran N, Ozer B, Duran GG, Onlen Y, Demir C. Antibiotic resistance genes & susceptibility patterns in staphylococci. Indian J Med Res. 2012; 135: 389-96[PubMed]
5. Havaei SA, Ghanbari F, Rastegari AA, Azimian A, Khademi F, Hosseini N, et al. Molecular Typing of Hospital-Acquired Staphylococcus aureus Isolated from Isfahan, Iran. Int Sch Res Notices. 2014; 2014: 185272[DOI][PubMed]
6. Shopsin B, Kreiswirth BN. Molecular epidemiology of methicillin-resistant Staphylococcus aureus. Emerg Infect Dis. 2001; 7(2): 323-6[DOI][PubMed]
7. Ghaznavi-Rad E, Nor Shamsudin M, Sekawi Z, Khoon LY, Aziz MN, Hamat RA, et al. Predominance and emergence of clones of hospital-acquired methicillin-resistant Staphylococcus aureus in Malaysia. J Clin Microbiol. 2010; 48(3): 867-72[DOI][PubMed]
8. Kawaguchiya M, Urushibara N, Kuwahara O, Ito M, Mise K, Kobayashi N. Molecular characteristics of community-acquired methicillin-resistant Staphylococcus aureus in Hokkaido, northern main island of Japan: identification of sequence types 6 and 59 Panton-Valentine leucocidin-positive community-acquired methicillin-resistant Staphylococcus aureus. Microb Drug Resist. 2011; 17(2): 241-50[DOI][PubMed]
9. Qi W, Ender M, O'Brien F, Imhof A, Ruef C, McCallum N, et al. Molecular epidemiology of methicillin-resistant Staphylococcus aureus in Zurich, Switzerland (2003): prevalence of type IV SCCmec and a new SCCmec element associated with isolates from intravenous drug users. J Clin Microbiol. 2005; 43(10): 5164-70[DOI][PubMed]
10. Chongtrakool P, Ito T, Ma XX, Kondo Y, Trakulsomboon S, Tiensasitorn C, et al. Staphylococcal cassette chromosome mec (SCCmec) typing of methicillin-resistant Staphylococcus aureus strains isolated in 11 Asian countries: a proposal for a new nomenclature for SCCmec elements. Antimicrob Agents Chemother. 2006; 50(3): 1001-12[DOI][PubMed]
11. Baddour MM, AbuElKheir MM, Fatani AJ. Comparison of mecA polymerase chain reaction with phenotypic methods for the detection of methicillin-resistant Staphylococcus aureus. Curr Microbiol. 2007; 55(6): 473-9[DOI][PubMed]
12. Vainio A, Karden-Lilja M, Ibrahem S, Kerttula AM, Salmenlinna S, Virolainen A, et al. Clonality of epidemic methicillin-resistant Staphylococcus aureus strains in Finland as defined by several molecular methods. Eur J Clin Microbiol Infect Dis. 2008; 27(7): 545-55[DOI][PubMed]
13. Vindel A, Cuevas O, Cercenado E, Marcos C, Bautista V, Castellares C, et al. Methicillin-resistant Staphylococcus aureus in Spain: molecular epidemiology and utility of different typing methods. J Clin Microbiol. 2009; 47(6): 1620-7[DOI][PubMed]
14. Stranden AM, Frei R, Adler H, Fluckiger U, Widmer AF. Emergence of SCCmec type IV as the most common type of methicillin-resistant Staphylococcus aureus in a university hospital. Infection. 2009; 37(1): 44-8[DOI][PubMed]
15. Gelatti LC, Bonamigo RR, Inoue FM, Carmo MS, Becker AP, Castrucci FM, et al. Community-acquired methicillin-resistant Staphylococcus aureus carrying SCCmec type IV in southern Brazil. Rev Soc Bras Med Trop. 2013; 46(1): 34-8[PubMed]
16. Standards N. Performance Standards for Antimicrobial Disk Susceptibility Tests: Approved Standards. NCCLS. 2015;
17. Azimian A, Havaei SA, Fazeli H, Naderi M, Ghazvini K, Samiee SM, et al. Genetic characterization of a vancomycin-resistant Staphylococcus aureus isolate from the respiratory tract of a patient in a university hospital in northeastern Iran. J Clin Microbiol. 2012; 50(11): 3581-5[DOI][PubMed]
18. Boye K, Bartels MD, Andersen IS, Moller JA, Westh H. A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I-V. Clin Microbiol Infect. 2007; 13(7): 725-7[DOI][PubMed]
19. Jansen WTM, Beitsma MM, Koeman CJ, Wamel W, Verhoef J, Fluit AC. Novel mobile variants of staphylococcal cassette chromosome mec in Staphylococcus aureus. Antimicrob Agents Chemother. 2006; 50(6)
20. Askari E, Soleymani F, Arianpoor A, Tabatabai SM, Amini A, Naderinasab M. Epidemiology of mecA-Methicillin Resistant Staphylococcus aureus (MRSA) in Iran: A Systematic Review and Meta-analysis. Iran J Basic Med Sci. 2012; 15(5): 1010-9[PubMed]
21. Kong EF, Johnson JK, Jabra-Rizk MA. Community-Associated Methicillin-Resistant Staphylococcus aureus: An Enemy amidst Us. PLoS Pathog. 2016; 12(10)[DOI][PubMed]
22. Mobasherizadeh S, Shojaei H, Havaei SA, Mostafavizadeh K, Davoodabadi F, Khorvash F, et al. Nasal carriage screening of community-associated methicillin resistant Staphylococcus aureus in healthy children of a developing country. Adv Biomed Res. 2016; 5: 144[DOI][PubMed]
23. Moghadami M, Japoni A, Karimi A, Mardani M. Comparison of community and healthcare-associated MRSA in Iran. Iranian J Clin Infect Dis. 2010; 5(4): 206-12
24. Ghasemian A, Najar-Peerayeh S, Bakhshi B. The comparison of staphylococcus aureus isolated from blood and wound specimens for genes encoding polysaccharide intercellular adhesion (PIA). Avicenna J Clin Microb Infec. 2015; 2(1): 1-5
25. Moghadam SO, Havaei SA, Pourmand MR. Prevalence of methicillin-resistant staphylococcus aureus carrying panton-valentine leukocidin gene in cutaneous infections in the city of Isfahan. J Med Bacteriol. 2012; 1(1): 1-16
26. Havaei SA, Vidovic S, Tahmineh N, Mohammad K, Mohsen K, Starnino S, et al. Epidemic methicillin-susceptible Staphylococcus aureus lineages are the main cause of infections at an Iranian university hospital. J Clin Microbiol. 2011; 49(11): 3990-3[DOI][PubMed]
27. Kilic A, Guclu AU, Senses Z, Bedir O, Aydogan H, Basustaoglu AC. Staphylococcal cassette chromosome mec (SCCmec) characterization and panton-valentine leukocidin gene occurrence for methicillin-resistant Staphylococcus aureus in Turkey, from 2003 to 2006. Antonie Van Leeuwenhoek. 2008; 94(4): 607-14[DOI][PubMed]
28. Hiramatsu K, Cui L, Kuroda M, Ito T. The emergence and evolution of methicillin-resistant Staphylococcus aureus. Trends Microbiol. 2001; 9(10): 486-93[PubMed]
29. Perez-Vazquez M, Vindel A, Marcos C, Oteo J, Cuevas O, Trincado P, et al. Spread of invasive Spanish Staphylococcus aureus spa-type t067 associated with a high prevalence of the aminoglycoside-modifying enzyme gene ant(4')-Ia and the efflux pump genes msrA/msrB. J Antimicrob Chemother. 2009; 63(1): 21-31[DOI][PubMed]
30. Fatholahzade B, Emaneini M, Alighli M, Gilbert G, Taherikalani M, Jonaidi N. Molecular characteristics of methicillin-resistant staphylococcus aureuscolones from a teaching hospital in Tehran. Jpn J Infect Dis. 2009; 62: 309-11
31. Mohammadia S, Sekawi Z, Monjezi A, Maleki M-H, Soroush S,, Sadeghifard N. Detection of methicillin-resistant Staphylococcus aureus by phenotypic methods. Med J Mashhad Univ Med Sci. 2005; 48: 7-16
32. Mariem BJ, Ito T, Zhang M, Jin J, Li S, Ilhem BB. Molecular characterization of methicillin-resistant Panton-valentine leukocidin positive staphylococcus aureus clones disseminating in Tunisian hospitals and in the community. BMC Microbiol. 2013; 13(2): 1-8
33. Mimica MJ, Berezin EN, Damaceno N, Carvalho RB. SCCmec Type IV, PVL-Negative, Methicillin-Resistant Staphylococcus aureus in Cystic Fibrosis Patients from Brazil. Curr Microbiol. 2011; 62(2): 388-90[DOI][PubMed]