Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis of Three Lipooligosaccharide-Associated Genes of <i>Campylobacter jejuni</i> and <i>Campylobacter coli</i> Isolated From Animal Samples

Rahem Khoshbakht; Mohammad Tabatabaei; Saeid Hosseinzadeh

doi:10.5812/ajcmi.11983

Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis of Three Lipooligosaccharide-Associated Genes of Campylobacter jejuni and Campylobacter coli Isolated From Animal Samples

Rahem Khoshbakht ^{1 , *} , Mohammad Tabatabaei ² and Saeid Hosseinzadeh ³

Authors Information

¹ Department of Food Hygiene, Faculty of Veterinary Medicine, Amol University of Special Modern Technologies, Amol, IR Iran

² Department of Pathobiology, School of Veterinary Medicine, Shiraz University, Shiraz, IR Iran

³ Department of Public Health and Food Hygiene, School of Veterinary Medicine, Shiraz University, Shiraz, IR Iran

Article Notes and Dates

Avicenna Journal of Clinical Microbiology and Infection: August 2017, 4 (3); e11983.Published Online: August 31, 2017

Article Type: Research Article; Received : April 23, 2017; Revised : July 1, 2017; Accepted : August 8, 2017
DOI: http://dx.doi.org/10.5812/ajcmi.11983

To Cite : Khoshbakht R, Tabatabaei M, Hosseinzadeh S. Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis of Three Lipooligosaccharide-Associated Genes of Campylobacter jejuni and Campylobacter coli Isolated From Animal Samples, Avicenna J Clin Microb Infec. 2017 ;4(3):e11983. doi: 10.5812/ajcmi.11983.

Abstract

Copyright: Copyright © 2017, Avicenna Journal of Clinical Microbiology and Infection. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

1. Background

The infections caused by thermophilic campylobacters, mainly Campylobacter jejuni, are recognized by symptoms ranging from mild diarrhea to serious neuropathies (1). Also, the pathogenesis of Campylobacter infections is not clearly understood, yet several virulence-associated genes have been described, most of which are associated with pathogenicity (2). One of the most important locuses of the Campylobacter genome is a highly changeable region, known as the lipooligosaccharide (LOS) biosynthesis locus, which has an effective role in some aspects of pathogenicity (3, 4). Various genetic features and variability of the LOS locus allow Campylobacter to establish a molecular mimicry between LOS of the bacterial cell wall and gangliosides in human peripheral nerves, which plays an important role in the pathogenesis of an acute paralytic neuropathy, known as Guillain-Barre’ Syndrome (5). Several genetic mechanisms are used by Campylobacter to turn on or turn off a gene to modulate the substrate specificities of the glycosyltransferases for LOS synthesis. Mechanisms include variation in homopolymeric tracts, single-base deletions, insertions and mutations, which cause the expression of different LOS structures (3, 6). Since different foods with animal origin have been incriminated as the main source for Campylobacter infections in humans (7), investigation of the LOS-associated virulence markers of Campylobacter strains isolated from food animals, such as broilers, cattle, and sheep is important.

2. Objectives

3. Methods

3.1. Bacterial Strains and Positive Controls

In the present study, the researchers used a total of 100 Campylobacter jejuni and C. coli strains, which had been isolated and recognized in previously published researches (8, 9). The isolates had been identified using cultivation and polymerase chain reaction (PCR) procedures with specific primers. Strains with positive results for presence of cgtB, wlaN, and waaC, LOS-associated genes were subjected to PCR-restriction fragment length polymorphism, using previous or new specific primers. Detailed information about positive strains for presence of the genes used in this study and their origins are listed in Table 1. In addition, the type strains C. jejuni (ATCC 33291) and C. coli (RTCC 2541) were included as positive controls for PCR reactions.

Table 1. Number Virulence-Associated Genes Amplicons and Their Sources Among Campylobacter Isolates

Species	Biological Origin	No. of Strains Generating Specific Gene Amplicon
		WlaN	CgtB	WaaC
C. jejuni	Cattle	10	5	10
	Sheep	5	7	8
	Chicken	22	8	25
C. coli	Cattle	4	0	7
	Sheep	1	5	7
	Chicken	27	4	28
total		69	29	85

3.2. DNA Concentration and PCR-RFLP Assay

Bacterial DNA, which had been previously extracted and purified by using the phenol-chloroform procedure, was used as DNA template in PCR reactions. The concentration of the DNA was estimated by spectrophotometry at 260 and 280 nm before PCR examination. The previously positive strains for presence of cgtB, wlaN and waaC genes (8, 9) were subjected to amplification of the complete sequence of the genes, using specific primers listed in Table 2. The PCR amplifications were performed in a final volume of 25 µL. The reaction mixtures consisted of 2 µL of the template DNA, 2.5 µL 10x PCR buffer (75 mM Tris-HCl, pH 9.0, 2 mM MgCl₂, 50 mM KCl, 20 mM (NH4)2SO4), 1 µL dNTPs (50 µM), 1 µL of 1U Ampli Taq DNA polymerase, and 1 µL of 25 pmol from the forward and reverse primers (CinnaGen, Iran), shown in Table 2, and the volume of the reaction mixtures were increased to 25 µL using distilled deionized water. The thermal cycler (MJ mini, BioRad, USA) was adjusted under the following conditions: initial denaturation at 94°C for 5 minutes, followed by 35 cycles of denaturation at 94°C for 1 minute, annealing as shown in Table 2 for 1 minute, and extension at 72°C for 1 minute. Final extension was carried out at 72°C for 7 minutes and the PCR products were remained in the thermal cycler at 4°C until they were collected.

Table 2. Nucleotide Sequences Used as Primers in the PCR Reaction for RFLP of the LOS Genes

Name of Primer	Sequence (5` to 3`)	Target Gene	Annealing Temperature, °C	Product Size, bp	Reference
wlaN F	AGGGTTTTAATAGTTGCAATTTCTC	wlaN (RFLP)	50	912	(10)
wlaN R	ATGAAATTTTTAATATCTTTACGGAATTAA	wlaN (RFLP)	50	912	(10)
waaC1	TAATGAAAATAGCAATTGTTCGT	waaC (RFLP)	42	1029	(10)
waaC2	GATACAAAAATCACTTTTATCGA	waaC (RFLP)	42	1029	(10)
cgtB F	TTAAGAGCAAGATATGAAGGTG	cgtB (RFLP)	56	562	(11)
cgtB R	GCACATAGAGAACGCTACAA	cgtB (RFLP)	56	562	(11)

The PCR products of wlaN, cgtB, and waaC genes were subjected for RFLP using HindIII and AluI restriction enzymes (Thermo scientific, Fermentas) in separate double repeat reactions. The amplicons were digested with 4 U of each restriction enzyme in 1.5 µL of 10x restriction buffer (Buffer R for HindIII and B1 buffer for AluI) and then incubated at 37°C for 15 hours, according to the manufacturer’s guidance. The digested PCR products (15 µL) were immediately separated on 2.5% agarose gel stained with ethidium bromide and photographed under UV transilluminator. The 100-bp DNA ladders were used as molecular markers to evaluate the size of the bands (Table 3).

Table 3. Distribution of the waaC Different RFLP Patterns Among Isolates

Origin (Number of Positives)	Species	waaC RFLP Pattern
		H1A1	H1A2	H1A3	H2A2	H2A3	H3A2
Chicken (53)	C. jejuni	9	6	2	0	8	0
Chicken (53)	C. coli	11	3	0	3	2	9
Cattle (17)	C. jejuni	4	2	0	0	4	0
Cattle (17)	C. coli	3	1	0	0	0	2
Sheep (15)	C. jejuni	4	2	1	0	2	0
Sheep (15)	C. coli	3	0	0	0	1	4
Total (86)		34	14	3	3	17	15

3.3. Sequencing and Alignment of Virulence Genes’ PCR Products

From PCR products of LOS-associated genes (wlaN, cgtB, and waaC), amplicons with the most prevalent RFLP pattern using combination of HindIII and AluI restriction enzymes were subjected for sequencing (Takapouzist Inc., Iran). To assess the diversity of the genes, they were compared with the GenBank databases, using the BLAST program maintained by the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov) and multiple sequence alignments were made by the ClustalW method, using the MEGA5 software (10).

3.4. Statistical Analysis

Statistical analysis was performed using the SPSS version 12.0.1 software. Discrete variables and proportions were compared using the Chi-square test with the significance level defined at P ≤ 0.05.

4. Results

4.1. The RFLP Results of LOS Genes

Among 69 wlaN gene PCR products, all RFLP patterns using 2 restriction enzymes (HindIII and AluI) were similar (Figure 1). Furthermore, all 29 cgtB gene PCR products showed similar RFLP patterns using 2 restriction enzymes (Figures 2 and 3). Among 86 waaC gene PCR products, 6 different RFLP patterns were obtained using 2 restriction enzymes in combination. Three patterns were obtained using each of the restriction enzymes separately (Figures 1 and 2) and the most prevalent pattern was H1A1 (detected in 40% of the waaC amplicons). These patterns and their frequency were H1A1 (34), H2A3 (17), H3A2 (15), H1A2 (14), H1A3 (3), and H2A2 (2).

Figure 1. RFLP Result of wlaN Gene Using Two Restriction Enzymes

Lanes 1 - 8, amplified wlaN gene digested with HindIII; Lane 9, wlaN PCR product; lanes 10 - 17, pattern of cut-off sites of AluI; lanes M, DNA marker (Vivantis, Malaysia).

Figure 2. RFLP Result of cgtB Gene Using HindIII Restriction Enzyme

Lanes 1 - 11, digestion pattern of PCR products; lane M, DNA marker (SM0331; Fermentas).

4.2. Nucleotide Sequence Accession Numbers and Sequence Analysis

Nucleotide sequences were deposited with GenBank section of the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov) and assigned accession numbers were as follows: wlaN gene, KY965833; cgtB gene, KY965832; waaC H1A1 pattern, KP715105; waaC H2A3 pattern, KR150515, and waaC H3A2 pattern, KR150516. The sequences of waaC amplicons showed more than 97% homology with the sequences previously reported for Campylobacter strains. The sequences of wlaN and cgtB amplicons showed more than 93% homology with the sequences of previously reported sequences (Figures 3 - 5).

Figure 3. RFLP Result of cgtB Gene Using AluI Restriction Enzyme

Lanes 1 - 6, pattern of digestion of PCR products; lane 7, cgtB PCR product lane M, DNA marker (SM0331; Fermentas).

Figure 4. RFLP Results of waaC Gene Using HindIII Restriction Enzyme

Lanes 2 - 4 and 7 – 9, pettern 1 (H1); lanes 5 and 6: pattern 2 (H2); lane 1, pattern 3 (H3); lane 10, waaC PCR product without effect of enzyme; lane M, DNA marker.

Figure 5. RFLP Results of waaC Gene Using the AluI Restriction Enzyme

Lanes 1 - 2, waaC PCR product without enzyme effect; lane 4, pattern 1 (A1); lane 5, pattern 2; (A2); Lanes 3 and 6, pattern 3 (A3) Lane M, DNA marker.

4.3. Statistical Analysis

The predominant pattern of waaC in PCR-RFLP, using 2 restriction enzymes among both C. jejuni and C. coli, was H1A1. The H1A3 pattern was not present in C. coli isolates and patterns H3A2 and H2A2 were not present in C. jejuni isolates. The H2A3 and H1A2 patterns were significantly higher in C. jejuni isolates compared with C. coli strains (P < 0.05). There were no significant correlations between waaC RFLP-pattern and Campylobacter origin.

5. Discussion

Ganglioside mimicry by Campylobacter Lipooligosaccharide (LOS) is considered an important factor in triggering of the Guillain-Barre and Miller-Fisher neuropathy syndromes after Campylobacter infections. Differences in the gene content of the LOS loci provide a basis for diversities in LOS outer cores among C. jejuni strains, which resulted in grouping to 8 LOS classes A-H (11), based on the organization of about 40 distinct genes. Muller et al. reported strain-specific differences in the occurrence of cgtB and wlaN genes, both of which encode a beta-1, 3-galactosyltransferase, connected with different abilities to colonize the chick gut and to invade Caco-2 cells (12). The results of a study performed by Muller et al. indicated that 80% of strains with no or weak colonization and invasion ability have no functional β-1, 3-galactosyltransferase encoded by cgtB or wlaN (6). Moreover, Feodoroff et al. showed that the presence of cgtB was associated with bloody stools, yet the other putative virulence factors did not correlate with any specific clinical findings (13). Moreover, the phase-variable expression of wlaN results in alternate ganglioside-mimicking LOS structures (14). Such differences, like gene variations and presence or absence of the gene in isolates with different origins or various geographic areas, could alter Campylobacter antigenic properties and change the ability of strains to infect their hosts. The researchers sequenced only one isolate of wlaN positive samples because all strains had similar RFLP pattern with two restriction enzymes. Indeed, all PCR products of cgtB and wlaN genes in the study showed a similar RFLP pattern using HindIII and AluI restriction enzymes. In contrast, cgtB gene PCR product was smaller in size than the PCR product of Godschalk et al. due to a difference in oligonucleotides used as primers (15). However, for wlaN gene, the researchers used the same primers yet the results in contrast, showed one RFLP pattern, which was due to the number of restriction enzymes used compared with 4 restriction enzymes used by Godschalk et al. (16). At either end of the LOS biosynthesis loci are the heptosyltransferase genes, like the waaC gene, which encodes a heptosyltransferase I, that surround regions exhibiting significant variation in ORF content. Thus, these organisms likely synthesize novel LOS structures (17).

From 3 LOS-associated genes in the present study only inner core associated waaC gene, showed different RFLP patterns using HindIII and AluI restriction enzymes in combination. This phenomenon may be due to variations in the gene. Surprisingly, the C. coli isolates RFLP pattern of waaC gene (P < 0.05) were dissimilar compared with C. jejuni strains RFLP pattern of waaC gene and some RFLP patterns were only found in C. jejuni isolates or showed low presence in C. coli isolates (H1A3 and H2A3), and some RFLP patterns were present only in C. coli isolates (H2A2 and H3A2). This phenomenon could be due to differences between C. jejuni and C. coli in LOS structure formation. In summary, PCR-RFLP analysis of the three LOS-associated genes of thermophilic Campylobacter spp. isolated from food animal fecal samples showed significant dissimilarity in waaC gene content. Sequence results of the current study showed the presence of homopolymeric tract (poly C and poly G) only in wlaN gene of Campylobacter jejuni obtained from a poultry origin. A large number of potential genes contain homopolymeric tracts in C. jejuni (18). This apparently chimeric arrangement is suggestive of some form of recombination and variation. Parkhill et al. demonstrated that homopolymeric tracts are associated with several loci in the C. jejuni genome and subject to high frequency mutation (as high as one in every 2 cells in a population) (18). These variations resulted in changes of the open reading frame and in expression of intact or truncated proteins. Despite the presence of such sequence in the wlaN sequence, there was diversity in wlaN amplicons using AluI and HindIII enzymes.

5.1. Conclusions

In conclusion, the study showed that Campylobacter spp. isolated from different sources have various LOS properties and variations of the genes occurred mainly in inner core-related genes. In addition, C. coli and C. jejuni have significantly various RFLP pattern in association with the waaC gene.

Acknowledgements

References

1. Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson MA, Roy SL, et al. Foodborne illness acquired in the United States--major pathogens. Emerg Infect Dis. 2011; 17(1): 7-15[DOI][PubMed]
2. Zilbauer M, Dorrell N, Wren BW, Bajaj-Elliott M. Campylobacter jejuni-mediated disease pathogenesis: an update. Trans R Soc Trop Med Hyg. 2008; 102(2): 123-9[DOI][PubMed]
3. Gilbert M, Karwaski MF, Bernatchez S, Young NM, Taboada E, Michniewicz J, et al. The genetic bases for the variation in the lipo-oligosaccharide of the mucosal pathogen, Campylobacter jejuni. Biosynthesis of sialylated ganglioside mimics in the core oligosaccharide. J Biol Chem. 2002; 277(1): 327-37[DOI][PubMed]
4. Leonard E2, Tompkins LS, Falkow S, Nachamkin I. Comparison of Campylobacter jejuni isolates implicated in Guillain-Barre syndrome and strains that cause enteritis by a DNA microarray. Infect Immun. 2004; 72(2): 1199-203[PubMed]
5. Ang CW, Jacobs BC, Laman JD. The Guillain-Barre syndrome: a true case of molecular mimicry. Trends Immunol. 2004; 25(2): 61-6[DOI][PubMed]
6. Muller J, Meyer B, Hanel I, Hotzel H. Comparison of lipooligosaccharide biosynthesis genes of Campylobacter jejuni strains with varying abilities to colonize the chicken gut and to invade Caco-2 cells. J Med Microbiol. 2007; 56: 1589-94[DOI][PubMed]
7. Delacretaz E, Soejima K, Stevenson WG, Friedman PL. Short ventriculoatrial intervals during orthodromic atrioventricular reciprocating tachycardia: what is the mechanism? J Cardiovasc Electrophysiol. 2000; 11(1): 121-4[PubMed]
8. Khoshbakht R, Tabatabaei M, Shirzad Aski H, Hosseinzadeh S. Occurrence of virulence genes and strain diversity of thermophilic campylobacters isolated from cattle and sheep faecal samples. Iran J Vet Res. 2014; 15(2): 138-44
9. Khoshbakht R, Tabatabaei M, Hosseinzadeh S, Shekarforoush SS, Aski HS. Distribution of nine virulence-associated genes in Campylobacter jejuni and C. coli isolated from broiler feces in Shiraz, Southern Iran. Foodborne Pathog Dis. 2013; 10(9): 764-70[DOI][PubMed]
10. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007; 24(8): 1596-9[DOI][PubMed]
11. Parker CT, Horn ST, Gilbert M, Miller WG, Woodward DL, Mandrell RE. Comparison of Campylobacter jejuni lipooligosaccharide biosynthesis loci from a variety of sources. J Clin Microbiol. 2005; 43(6): 2771-81[DOI][PubMed]
12. Muller J, Schulze F, Muller W, Hanel I. PCR detection of virulence-associated genes in Campylobacter jejuni strains with differential ability to invade Caco-2 cells and to colonize the chick gut. Vet Microbiol. 2006; 113(1-2): 123-9[DOI][PubMed]
13. Feodoroff B, Ellstrom P, Hyytiainen H, Sarna S, Hanninen ML, Rautelin H. Campylobacter jejuni isolates in Finnish patients differ according to the origin of infection. Gut Pathog. 2010; 2(1): 22[DOI][PubMed]
14. Linton D, Gilbert M, Hitchen PG, Dell A, Morris HR, Wakarchuk WW, et al. Phase variation of a beta-1,3 galactosyltransferase involved in generation of the ganglioside GM1-like lipo-oligosaccharide of Campylobacter jejuni. Mol Microbiol. 2000; 37(3): 501-14[PubMed]
15. Godschalk PC, Kuijf ML, Li J, St Michael F, Ang CW, Jacobs BC, et al. Structural characterization of Campylobacter jejuni lipooligosaccharide outer cores associated with Guillain-Barre and Miller Fisher syndromes. Infect Immun. 2007; 75(3): 1245-54[DOI][PubMed]
16. Godschalk PC, van Belkum A, van den Braak N, van Netten D, Ang CW, Jacobs BC, et al. PCR-restriction fragment length polymorphism analysis of Campylobacter jejuni genes involved in lipooligosaccharide biosynthesis identifies putative molecular markers for Guillain-Barre syndrome. J Clin Microbiol. 2007; 45(7): 2316-20[DOI][PubMed]
17. Gilbert M, Godschalk PCR, Parker CT, Endtz HP, Wakarchuk WW. Genetic bases for the variation in the lipooligosaccharide outer core of Campylobacter jejuni and possible association of glycosyltransferase genes with post-infectious neuropathies. 2005;
18. Parkhill J, Wren BW, Mungall K, Ketley JM, Churcher C, Basham D, et al. The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature. 2000; 403(6770): 665-8[DOI][PubMed]

Avicenna Journal of Clinical Microbiology and Infection

Published by: Kowsar