This Article

Citations


Creative Commons License
Except where otherwise noted, this work is licensed under Creative Commons Attribution-NonCommercial 4.0 International License.
This article, by Hamadan University of Medical Sciences , is licensed under a Creative Commons Attribution License .

The Comparison of Staphylococcus aureus Isolated From Blood and Wound Specimens for Genes Encoding Polysaccharide Intercellular Adhesion (PIA)


1 Department of Bacteriology, Tarbiat Modares University, Tehran, IR Iran
*Corresponding author: Shahin Najar-Peerayeh, Department of Bacteriology, Tarbiat Modares University, Tehran, IR Iran. Tel: +98-92182883870, Fax: +98-2182884555, E-mail: .
Avicenna Journal of Clinical Microbiology and Infection. 2015 March; 2(1): e25171 , DOI: 10.17795/ajcmi-25171
Article Type: Research Article; Received: Nov 6, 2014; Revised: Nov 28, 2014; Accepted: Dec 17, 2014; epub: Feb 14, 2015; ppub: Mar 2015

Abstract


Background: The polysaccharide intercellular adhesion (PIA) produced by Staphylococcus aureus is effective in the protection of isolates from outer harsh conditions and progress of infection.

Objectives: The aim of this study was to compare the icaABCD genes encoding polysaccharide intercellular adhesion (PIA) between blood and wound isolates of Staphylococcus aureus (S. aureus) in Tehran.

Patients and Methods: Forty-eight clinical isolates (including 30 blood and 18 skin wounds) were collected from patients and were identified. Next, mecA gene, SCCmec types and icaABCD genes were detected among blood and wound isolates of S. aureus by PCR assay and specific primers.

Results: Nine (19%) out of 12 methicillin resistant S. aureus (MRSA) isolates harbored SCCmec type III and three (6.2%) isolates harbored SCCmec type V. Prevalence of icaA, icaB, icaC and icaD in blood isolates was twenty-one (70%), fourteen (48%), nineteen (64%) and eighteen (60%), respectively; while the prevalence in wound isolates was as nine (50%), seven (39%), six (34%) and twelve (67%), respectively.

Conclusions: These findings showed no significant difference regarding the presence of icaADBC genes between blood and wound isolates.

Keywords: Methicillin-Resistant Staphylococcus aureus; Biofilm

1. Background


Staphylococcus aureus (S. aureus), especially those with methicillin resistance, are versatile pathogens capable of causing various clinical symptoms; ranging from mild and self-limited, to severe infections culminating in fatal outcomes (1). Staphylococcal bacteremia, particularly infections with methicillin resistant S. aureus (MRSA) isolates, has sharply increased during the recent years and is more strongly associated with mortality than other bacterial agents (2). Attachment and colonization is the first step for S. aureus pathogenesis. Biofilm formation allows the bacteria to resist higher concentrations of antimicrobial agents, environmental conditions and the host immune responses (3). The self-produced polymeric matrices (PIA) attach to inert and living surfaces (4). Penetration of antibiotics becomes impaired through S. aureus and S. epidermidis biofilms (5), although carbon and amino acids can be adsorbed by the biofilm layers (6). Infections with the ability to produce a slime layer are difficult to treat (7). Many persistent and chronic infections due to S. aureus, especially by medical devices, are particularly associated with biofilm formation (8, 9). Strong biofilm-producing isolates are more virulent, and cause severe post-surgical infections (10). The icaADBC genes play an important role in biofilm formation among both S. aureus and S. epidermidis isolates. Among ica genes, icaA encodes the enzyme responsible for PIA synthesis. This enzyme requires the product of icaD (IcaD) for full activity (11). Co-expression of icaA and icaD induces higher enzymatic activity (12). The other genes within the ica gene cluster are icaB (polysaccharide deacetylase), icaC (transporter of PIA) and icaR (the regulator gene). In Akiyama’s study, all S. aureus cells isolated from skin wounds of impetigo, atopic dermatitis and pemphigus produced glycocalyx and formed microcolonies (13). Most strains of S. aureus contain the all four genes of ica operon, although some reports have detected only some of these genes (7).

2. Objectives


The objective of this study was to detect icaADBC genes and to compare them between blood and wound isolates of S. aureus.

3. Patients and Methods


3.1. Clinical isolates

Thirty blood and 18 wound isolates of S. aureus were collected from July 2012 to January 2013. The isolates were confirmed with coagulase, mannitol fermentation, colony morphology and DNase tests.


3.2. Antibiotic Susceptibility Test

An antibiotic susceptibility test was performed according to Clinical and Laboratory Standards Institute (CLSI) Guidelines, with the Kirby Bauer assay. Antibiotic disks comprised of amoxicillin (10 µg), gentamycin (10 µg), tetracycline (30 µg), trimethoprim-sulfamethoxazole (25 µg), erythromycin (15 µg), clindamycin (2 µg), oxacillin (1 µg), vancomycin (30 µg), ciprofloxacin (5 µg) and linezolid (30 µg), (MAST, UK).


3.3. Genomic DNA Extraction

Bacterial isolates were suspended in 200 µL of tris-EDTA buffer, followed by addition of lysostaphin (comprising of 200 µL of TE buffer and 20 µL of lysostaphin [2 µg/mL, Sigma]). Briefly, after incubation for one hour, two steps of boiling were done for 15 minutes, and then the micro-tubes were centrifuged. Genomic DNA of S. aureus isolates was isolated according to the Straubinger method (14).


3.4. DNA Amplification

The mecA gene was detected with specific primers indicated in Table 1 (15). The PCR reaction mixture comprised of 9.5 µL distilled water (DW), 2 µL deoxyribonucleotide triphosphates (DNTPs) (10 mM), 1.5 µL MgCl2 (50 mM), 1 µL of each primer, 3 µL 10 × PCR buffer (200 mM), 2 µL Taq polymerase (500 U) and 5 µL template DNA. The thermal profile included initial denaturation at 94ᵒC for five minutes, followed by 30 cycles at 94ᵒC (30 seconds), 55ᵒC (30 seconds) and 72ᵒC (30 seconds) and final extension at 72ᵒC (four minutes). The reaction mixture for SCCmec types was at 94ᵒC (one minute), 51ᵒC (one minute), 72ᵒC (1.5 minute) and final extension at 72ᵒC for 10 minutes. Moreover, thermal profile for icaA gene concluded at 94ᵒC (five minutes), followed by 30 cycles at 94ᵒC (one minute), 52ᵒC (30 seconds) and 72ᵒC (1.5 minute) with final extension at 72ᵒC (10 minutes). The annealing temperature for icaB, icaC and icaD was set at 55ᵒC for one minute (16). The DNA of the positive control isolate for the genes was kindly provided by Dr. Ghaznavi Rad. We also used the reaction mixture without template as the negative control.


Table 1.
Table 1.
Specific Primers for Genes Amplified in This Study

3.5. Electrophoresis of Products

The PCR products were electrophoresed on 1% gel agarose, and were observed with 1 µL of each loading buffer and gel red stains under UV emission.


3.6. Data Analysis

Student's t-test was used for data analysis. A P value of less than 0.05 was considered as significant.

4. Results


4.1. Antibiotic Susceptibility Test

Among the total of 48 isolates, 39 (81.2%) were resistant to amoxicillin, although all of the clinical isolates were susceptible to linezolid and vancomycin. Resistance to tetracycline, gentamycin, trimethoprim-sulfamethoxazole, erythromycin, clindamycin, ciprofloxacin and oxacillin were 58.4%, 21%, 17%, 18%, 16%, 17% and 25%, respectively. The MRSA strains were significantly more resistant to the majority of antibiotics. Blood and wound isolates had no significant difference regarding resistance to antibiotics.


4.2. The mecA Gene and SCCmec Types

Twelve (25%) isolates harbored mecA gene with a 147 base pair (bp) size. The majority of MRSA isolates (nine isolates or 19% of total) harbored SCCmec type III, followed by type V (three isolates or 6.2%)(Table 2).


Table 2.
Table 2.
Characteristics of Methicillin Resistant S. aureus Strains Tested in This Study a

4.3. Prevalence of icaA, icaB, icaC and icaD Genes

The prevalence of icaA, B, C, D in blood isolates was 21 (70%), 14 (48%), 19 (64%) and 18 (60%), respectively; while in wound isolates prevalence of these isolates was nine (50%), seven (39%), six (34%) and 12 (67%), respectively. The icaA and icaC were more frequent in blood isolates. Fourteen (29.1%) blood isolates harbored all four icaADBC genes of the operon. The icaA and icaD genes were more frequent in the wound isolates. Seven (39%) Wound isolates had all four icaADBC genes. Also six out of twelve (50%) MRSA isolates harbored all icaADBC genes. There was no relationship between resistance to antibiotics and presence of icaADBC genes. The MRSA isolates harbored a high number of icaADBC genes, suggesting that MRSA may be more capable of producing PIA and biofilms.

5. Discussion


All studied isolates were susceptible to vancomycin and linezolid, although these drugs are the last resort for use against S. aureus. Resistance to vancomycin has been reported from several parts of the world in sporadic conditions, similar to Iran (17, 18). In our study, MRSA isolates were resistant to more antibiotics when compared to MSSA strains, and this difference between the two groups was significant for several antibiotics. However, one MRSA isolate, with SCCmec type V was susceptible to all antibiotics used, except for amoxicillin. This strain was isolated from a wound culture of a woman. Moreover, this isolate harbored the icaAD genes. The majority of MRSA strains in this study harbored SCCmec type III, which is important in healthcare associated infections or HA-MRSA infections. Similarly, our previous studies and Japoni’s survey from south of Iran, depicted that SCCmec type III was the predominant SCCmec type (19-21). In this study, one MRSA with SCCmec type III was resistant to all the antibiotics, except for vancomycin and linezolid. This strain was isolated from a blood culture of a woman, and harbored all icaADBC genes, suggesting an isolate with strong biofilm production and resistance to the used antibiotics. Biofilm formation protects S. aureus strains against environmental factors, antibiotics and host responses, and is considered to cause chronic and persistent infections (22). Polymeric intercellular adhesion (PIA) plays an important role in attachment of S. aureus strains to each other and accumulation of a multi-layered biofilm. Catheter and bloodstream Staphylococcal infections play an important role in biofilm formation and persistent infections (23, 24). There was no significant difference between blood and wound isolates of S. aureus regarding the presence of icaADBC genes, however most previous studies have not compared icaADBC genes between these two clinical sources. Several studies have detected icaA and icaD genes with high prevalence among S. aureus isolates (25) and several have reported that all the isolates were icaA positive. However, Hou reported that, 55.56% of isolates produced biofilms phenotypically, yet 11.11% harbored the icaA gene (26), while the other genes were not investigated. This study showed that icaADBC genes are more frequent in MRSA isolates, similar to Mirzaee, Khan and O'Neill studies (27-29). However, Smith believed that there is no significant correlation between susceptibility to methicillin and biofilm formation (30). The variations in the presence of icaADBC genes from different studies might be due to the epidemiological varieties and time at which clinical isolates were collected.


Similar to this study, several previous surveys have not exhibited significant differences between MRSA and MSSA isolates or between blood and wound isolates, but have shown that icaAD genes play important roles in PIA synthesis (31-34). Similarly, in this study, icaADC genes were the predominant genes among blood and wound isolates. However, Smith depicted that isolates of S. aureus from infected skin wounds were significantly more capable of producing biofilms than those isolated from blood and other infected sites (30).


There was no significant difference between blood and wound isolates of S. aureus regarding presence of icaADBC genes. The icaADBC genes were more frequent among MRSA isolates; but no significant difference was observed between MRSA and MSSA strains.

Acknowledgments

The authors acknowledge the Loghman Hospital staff for providing the clinical isolates.

Footnotes

Authors’ Contributions: Abdolmajid Ghasemian performed the laboratory work. Shahin Najar Peerayeh designed the work, and Bita Bakhshi advised the work.
Funding/Support: This work was supported by grants from Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran.

References


Table 1.

Specific Primers for Genes Amplified in This Study

Primer, Sequence: 3'→5' Primer Size Reference
mecA 147 (15)
F:GTG AAG ATA TAC CAA GTG ATT
R: ATG CGC TATAGATTGAAA GGA
SCCmecI 613 (15)
F: GCTTTAAAGAGTGTCGTTACAGG
R: GTTCTCTCATAGTATGACGTCC
SCCmecII 398 (15)
F: CGTTGAAGATGATGAAGCG
R: CGAAATCAATGGTTAATGGACC
SCCmecIII 280 (15)
F: CCATATTGTGTACGATGCG
R: CCTTAGTTGTCGTAACAGATCG
SCCmecIV 776 (15)
F: GCCTTATTCGAAGAAACCG
R: CTACTCTTCTGAAAAGCGTCG
SCCmecV 325 (15)
F: GAACATTGTTACTTAAATGAGCG
R: TGAAAGTTGTACCCTTGACACC
icaA 188 (16)
F: ACACTTGCTGGCGCAGTCAA
R: TCTGGAACCAACATCCAACA
icaB 900 (16)
F: AGAATCGTGAAGTATAGAAAATT
R: TCTAATCTTTTTCATGGAATCCGT
icaC 1100 (16)
F: ATGGGACGGATTCCATGAAAAAGA
R: TAATAAGCATTAATGTTCAATT
icaD 198 (16)
F: ATGGTCAAGCCCAGACAGAG
R: AGTATTTTCAATGTTTAAAGCAA

Table 2.

Characteristics of Methicillin Resistant S. aureus Strains Tested in This Study a

MRSA CS mecA SCCmec ica Genes Antibiotic Resistance
1 lesion P III A Amx, Cip, E, T, CD
2 lesion P V AD Amx
3 blood P III ADBC Amx, Cip, T, CD, GM
4 blood P III AD Amx, Cip, E, T, CD, GM
5 blood P III ADBC Amx, T, E
6 lesion P V A Amx, Cip, E, T, CD
7 lesion P III ADBC Amx, Cip, E, T, CD, GM
8 lesion P III 0 Amx, Cip, E, T, CD, GM
9 blood P V ADBC Amx, T, Cip
10 blood P III 0 Amx, Cip, E, T, CD, GM
11 blood P III ADBC Amx, Cip, E, T, CD, GM
12 blood P III ADBC Amx, Cip, E, T, SXT, CD, GM
a Abbreviations: Amx, amoxicillin; CD, clindamycin; Cip, ciprofloxacin; CS, clinical specimen; E, erythromycin; GM, gentamicin; SXT, trimethoprim-sulfamethoxazole; T, tetracycline.